Mapping with SSLP markers

From Wikionchus

Jump to: navigation, search

Contents

Intro

"SSLP" stands for " simple sequence length polymorphism" and is a type of molecular marker that has long been used in diverse model orgainsm. We have recently developed SSLP markers for Pristionchus pacificus as an alternative to SSCP markers. SSLPs are PCR amplicons that cover small indels that exist between the reference ( "Calfornia", PS312) or mapping strain("Washington", PS1843). These indels are large enough to be visualized on agarose gels.

The advantage of SSLPs over SSCPs are: -faster -cheaper

The disadvatages: -can not be generated at such high density

Finding SSLP markers

We developed SSLPs for special regions of the genome where recombinations are low and therefore many animals need to be tested for mapping. Christoph Dieterich used a whole genome alignment of he California and Washington whole-genome-shotgun sequencing projects to find indels and predict suitable primers. The predictions are stored in a .txt file which you can download here: Text file with Indel primers

I will explain the content of this file based on an example:

EXAMPLE:

line 1: PpaCal.Contig161.39 15423 15551 129

line 2: PpaWash.Ppa_wash_5109 175 335 161

line 3: 161

line4 :TACAAAACATTCAACCTTCACCAAAGTCAACCAACTATCAAGGAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCCATTCTAAGTGNAATTCTAATTGAGCGCCGGTCATATGCAATCGATTCCTTGAAAATGAGTGGGGTGGAATGGAA

line 5: There were 5 results for seq bla of length 161

line 6: Left primer: CCTTCACCAAAGTCAACCAA 20

line 7: Right primer: CCCCACTCATTTTCAAGGAA 20

line 8: Amplicon length: 137

line 9: Amplicon: ccttcaccaaagtcaaccaaCTATCAAGGAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCCATTCTAAGTGNAATTCTAATTGAGCGCCGGTCATATGCAATCGAttccttgaaaatgagtgggg


EXPLANATION AND COMMENTS:

line 1: Contig of California assembly "freeze 1" - use the string "ContigXY.Z " to search for your contig of interest. If you find your contig you need to make sure that line 5 contains more than 0 results - i.e. the alignment allows the prediction of a SSLP.

line 2: The corresponding Washington contig - not important for you.

line 3: Length of aligned sequence - set to 80 bp upstream and sownstream of the indel - not important

line 4: Sequence of the alignment - indels are indicated by "N" - the more Ns you find the easier it is to see the difference on the gel. Note that the deletion can occur in EITHER California OR Washington.

line 6 and 7: Suggested Primer sequences - designed for 55°C Ta.

line 8: Predicted amplicon length.

line 9: Amplicon sequence.

Of course every SSLP marker has to be tested before it can be used for mapping. If you´re a member of the Sommer-lab go to room 217 and ask Benjamin S. for an introduction. If you are not I am more than happy to answer questions by email (benjamin.schlager@tuebingen.mpg.de).

SSLP mapping PCRS

Exactly the same as for SSCP. I use 40 PCR cycles.

SSLP Agarose gels

Mapping gels are large format 100-slot 2% Agarose gels in 1X TBE. We use a mixture of standard agarose and Genaxxon genTiny Agarose. This is a special agarose that gives higher resolution. It is also very expensive so use it carefully! Gels are:

- 4g standard agarose

- 4g Genaxxon agarose

- 400 ml TBE

- microwave: 5 minutes 900 Watts

- add Ethidiumbromide while the gel is hot

- 8 µl Ethidiumbromide (10mg/ml stock)

I load the gels with 8-channel multichannel pipettes. Eat something before you load the gels - you don´t want your hands to tremble. Gels are run for 2h at 200 V.

Personal tools